1 Bases moleculares de la tolerancia a disolventes orgánicos en Pseudomonas A. Segura, E. Duque, F. Junker, G. Mosqueda, A. Rojas, P. Godoy, A. Hurtado, W. Teran, M. T. Gallegos and J.L. Ramos CSIC-Estación Experimental del Zaidín Granada ESPAÑA

2 Los microorganismos tolerantes a disolventes orgánicos son útiles para: 4 Descontaminación de sitios muy contaminados 4 Biotransformaciones en sistemas de doble fase 4 Biosensores

3 *Inoue and Horikoshi, 1991, Nature 338, 264-266 Pseudomonas putida, toluene tolerant *Cruden et al., 1992, Appl. Environ. Microbiol. 58, 2723-2729 P. putida, p-xylene tolerant *Weber et al., 1993, Appl. Environ. Microbiol. 59, 3502-3504 P. putida, styrene tolerant *Ramos et al., 1995, J. Bacteriol. 177, 3911-3916 P. putida, toluene tolerant and able to use toluene as the only carbon source

4 Cepas tolerantes a tolueno *Pseudomonas putida DOT-T1E (aguas residuales) *Pseudomonas putida MTB6 (suelo) *Pseudomonas putida S12

5 Crecimiento de P. putida DOT-T1E in presencia de disolventes orgánicos a Disolventes log P ow Crecimiento (OD 660 ) n-Decano n-Octano n-Heptano Propilbenzeno Dietilphthalato Ciclohexano Ethilbenzeno p-xileno Estireno Tolueno 1-Heptanol Dimethilphthalato Benzeno Cloroformo Butanol 5.6 4.5 4.1 3.6 3.3 3.2 3.1 3.0 2.5 2.4 2.3 2.0 0. 8 >2.0 >1.0

6 LB LB+tol(g) +0.3% tol-0.3% tol +0.3% tol 10 -1 10 -3 10 -5 10 -7...................................... 10 -1 10 -3 10 -5 10 -7...................................... 10 -1 10 -3 10 -5 10 -7..................................... 10 -1 10 -3 10 -5 10 -7............................

7 2004060 0 5 10 Tiempo (min) Log UFC TOLERANTE

8 LB LB+tol(g) +0.3% tol-0.3% tol +0.3% tol 10 -1 10 -3 10 -5 10 -7 10 -1 10 -3 10 -5 10 -7 10 -1 10 -3 10 -5 10 -7 10 -1 10 -3 10 -5 10 -7.................................................................................................................

9 200 40 60 0 5 10 Tiempo (min) Log UFC SENSIBLE

10 2004060 0 5 10 Tiempo (min) Log UFC 2004060 0 5 10 Tiempo (min) Log UFC TOLERANTESENSIBLE

11 ¿Porqué son Pseudomonas DOT-T1E and MTB6 tolerantes a tolueno? 4 Barreras bioquímicas que implican el catabolismo 4 de los compuestos 4 Bombas de extrusión 4 Barreras físicas que incrementan la rigidez de membrana

12 ¿Está el catabolismo de los disolventes orgánicos implicado en la tolerancia? Hay cepas tolerantes que no los degradan Ver si mutantes que no degradan los disolventes y son igual de tolerantes que la cepa silvestre

13 CH 3 ISP TOL (todC1C2) Ferredoxin TOL (todB) Reductase TOL (todA) NAD + NADH+H + O2O2 CH 3 OH H H toluene cis-toluene dihydrodiol NAD + (todD) NADH+H + CH 3 OH 3-Methylcatechol O2O2 (todE) Ring fission

14 XFC1C2BATSIGEDH Time (minutes) Log CFU TodC1 mutant tod

15 CC118 pir pUTkan-phoADOT-T1E phoAkamR Benzoato/Kan/Azules

16 Kan R PhoA SphI Kan R SphI

17 Kan R NotISphI NotI SphI NotI Marcaje con DIG

18 Crecimiento en presencia de disolventes orgánicos Ninguno Etilbenzeno log P ow 3.5 Octanol log P ow 2.8 Tolueno log P ow 2.5 Silvestre + + + DOT-T1E-18 + + + -- DOT-T1E42 + + + -- DOT-T1E109 + + + --

19 ¿Porqué son Pseudomonas DOT-T1E and MTB6 tolerantes a tolueno? Barreras bioquímicas que implican el catabolismo de los compuestos Otros factores Barreras físicas que aumentan la rigidez de la membrana Bombas de extrusión

20 Bombas de eflujo

21 ¿Es la tolerancia a disolventes un proceso dependiente de energía? *El rendimiento de cultivos crecidos en tolueno es un 30% del obtenido en ausencia de tolueno *Cuanto mayor es la polaridad del disolvente menor es el rendimiento del cultivo

22 Incorporación de 1,2,4-[ 14 C]-triclorobenzeno en membranas celulares de P. putida cells Condiciones 14 C/mg proteína celular No-tratadas 20.000 Tratadas con FCCP 300.000

23 Incorporación de 1,2,4-[ 14 C]-triclorobenzeno en membranas celulares of P. putida Condiciones de cultivo 14 C/mg proteína celular Silvestre DOT-T1E18 LB LB+ tolueno 66.000 59.000 301.000 124.000

24 DOT-T1E-18 ttgRttgA ttgB ttgC Pertenecen a la familia de las RND (resistencia, nodulación, división celular) TtgB tiene una alta homología con MexB de Pseudomonas aeruginosa La bomba está formada por tres componentes

25 TtgB TtgC TtgA membrana externa Espacio periplásmico membrana interna CH 3 3 3 3 3 3 ?

26 NH 2 COOH A B C D Citoplasma

27 TtgCTolC

28 ttgRttgA ttgB ttgC 9 5 1 02040 20 0 log UFC ml -1 Tiempo (min)

29 XFC1C2BATSIGEDH todStodTttgFttgEttgD 1 Kb

30 ttgDttgEttgF   ttgDttgE´ ttgEttgF 1 1 2 2  ´ttgE ttgD ttgE  ttgDttgE´´ttgE ttgF ttgD ttgE´ ´ttgE ttgF ´ttgE´ ´ttgE ttgF ttgFE´´ttgE

31 1 40 2000 Células viable (log UFC ml -1) Tiempo (min) 9 5 DOT-T1E DOT-T1E-1 DOT-T1E-18DOT-T1E-82 2040 5 9 1

32 gen DNA 5´3´ ATG Stop Inductor RNA P 32

33 XFC1C2BATSIGEDH todStodTttgFttgEttgD 1 Kb

34 0 DOT-T1E-82 2040 Células viables (log UFC ml -1) Tiempo (min) 1 5 9

35 ttgVttgG ttgH ttgI ttgW 1 40200 0 Células viables (log UFC ml -1) Tiempo (min) 9 5 DOT-T1E DOT-T1E-1 DOT-T1E-18 DOT-T1E-28 2040 5 9 1

36 ttgVttgG ttgH ttgI ttgW A C GT -tol +tol

37 Crecimiento en LB+tol (g) Tiempo (horas) log D.O 660 0,1 0,01 1 10 0 515 102025

38

39

40 SustratosTtgABCTtgDEFTtgGHI Tolueno Estireno m-xileno Propilbenceno Etilbenceno Tetraciclina Ampicilina Cloramfenicol Gentamicina Nalidixíco Carbenicilina ++++++++++ ++++++++++ ++---++--- ------------ +++-+++++-++ +++-+++++-++

41 Células viables (log UFC ml -1) Tiempo (min) 9 5 DOT-T1E DOT-T1E-1 4020 0 DOT-T1E-18DOT-T1E-28 4020 0 4020 0 4020 0 TtgABC TtgDEFTtgGHI Silvestre

42 ttgVttgG ttgH ttgI ttgW ttgTttgD ttgE ttgF ttgRttgA ttgB ttgC A G T C 1 2 3 4 A C GT -tol +tol

43 ttgRttgA ttgB ttgC TTGCATGAGGATCCTCGGGTCGCTGGAGCAGGGAGACGCTCAAGAGTAATGGAA GAGATCTTGATCTGGAAAAAATGCTATCCGGTGGATAAATAGCTTGCTAAGGAA TATACTTACATTCATGGTTGTTTGTAAATACTGCTGGGTGGTACTCAGGTACAG CCTCAGCGCTTGATTAGCTTATCCGAGAGGCCCCGGCAGAGGTGCCCCCGGAGC GTTCCCCGCACGCGCTGCGCGTTCGGGCCAGATGAGGTTGTACTGCCATGGTC ttgA ttgR C 1 55 109 163 217 1 2 3 4 5 6 165bp 220bp

44 SUPERVIVENCIA (log UCF/ml) TIEMPO (min) 8 6 4 2 DOT-T1E DOT-T1E-18 DOT-T1E-13 DOT-T1E-15 8 6 4 2

45 Susceptibilidad a antibióticos Genotipo Cb Cm Nal DOT-T1E Silvestre 128 64 DOT-T1E-18 ttgB::Tn5 1632 DOT-T1E-13 ttgR::  Km 1024256 512 Tc 4 8 0,24 25616 MIC (  g ml -1 )

46 ttgV ttgG ttgH ttgI ttgW m-RNA c-DNA Transcripción reversa PCR

47 A C GT -tol +tol V-GG-HH-I Controles negativos V-W ttgV ttgG ttgH ttgI ttgW

48 A TtgG CT AC G G T ++ - - TtgV ttgVttgG ttgH ttgI ttgW

49 8 6 4 2 SUPERVIVENCIA (log CFU/ml) TIEMPO (min) DOT-T1E D 8 6 4 2 B 03060 03060 C TtgV - TtgW - TtgVW - ttgHttgVttgGttgIttgW aphA  Kam DOT-T1E TtgV - TtgW - TtgVW -

50 Wt PS52 PS61 PS62 0 1000 2000 P ttgG 0 1000 2000 P ttgV Wt PS52 PS61 PS62 ttgW - ttgV - ttgvW - ttgW - ttgV - ttgvW - Unidades Miller

51 24 29 36 45 66 20 14,2 A 24 29 36 45 20 14,2 B 1 2 31 2 3 4 5 6 7 8

52 0,50 5 500,5 5 50500 ng DNA no marcado Específico Inespecífico nM TtgV501501000

53 TtgV DNasa

54 GCGTCAAGAGTATCACATAA  g His-TtgV 0 4.0 Fragment Abundance

55 Strain 0.1% toluene N.I. I 0.3% toluene N.I. I Toluene tolerance P. putida DOT-T1E 1 110 -4 -10 -5 0,5-1 H P. putida MTB6 1 110 -4 -10 -5 10 -1 H P. putida S12 1 110 -6 10 -2 -10 -3 M/H P. putida MTB5 10 -4 1

56 StrainsTolerancettgABCttgDEF ttgGHI P. putida DOT-T1E H + + + P. putida MTB6 H + + + P. putida S12 H + - + P. putida F1 M + + - P. putida MTB5 M + + - P. putida SMO116 M + + - P. putida 43 M + - - P. putida JLR11 M + - - P. putida 2440 S + - - P. putida OUS82 S + - -

57 Reparación de membranas

58 Composición de los grupos de cabeza de los fosfolípidos de P. putida DOT-T1E en ausencia y presencia de disolventes orgánicos Disolvente orgánico PEPGCL PE PG+CL Ninguno 78 10 12 3.5 Tolueno (1% vol/vol) 65 9 26 1.8

59 Proporción de lípidos insaturados Cis/trans de Pseudomonas creciendo en ausencia y presencia de 0.5% (vol/vol) de disolventes orgánicos None Heptane Ethylbenzene m-Xylene Toluene 7.5 3.0 1.0 0.9 1.0 Cis/trans

60 Disolventes Ácidos grasos saturadosisómero-cisisómero-trans

61 C14:0 C16:1 cis C16:1 trans C16:0 C17:ciclopropano C18:2 cis cis C18:1 cis ol C18:1 cis va C18:1 trans va C18:0 cis/trans saturado/insaturado LBLB +1%(v/v) tolueno 1.0 35.4 5.1 35.0 1.1 1.0 4.0 24.3 0.0 0.95 11.1 0.62 1.0 25.3 14.3 33.3 1.0 3.0 20.0 3.9 0.9 2.55 0.45

62 actcti metH 182bp TACCT 5´- CATAGGAACTACCTGGTCGGGCGAATATCAGAAGGTGCCGAATCATAACAAA GCTGCGCGGTTTTTAGGCATGTCGCCCATTTGCATGAAAACTGCTCATGTTG GGCGGGTGGAGGCAGCGCAAGGCACCCAGGACGACCAGGCAACAAATCGTGA TGGCTTTCAAGAACCAGGACTTTCCGCACATG-3´ 194bp 5´-TGATCGGGTTGGCTGACCTTTCCGAGTACCTTGCGGTCGGAATGGGTG GGTGGTCTTGATCGATTGCAAAGGGGGCTGCTTTGCAGCCCTTCGCGG GTGAACCCGCTCCTACAACAGGTACGGCGCTGCTCTGAAGGCTGGCGC TGGCCTCTGCACTCGATACGGGCCTCAATGCACCGCCAAGCGCAGGGT ATTCCATG-´3 BglII SphI 2.9 kbp2.4 kbp1.6 kbp  6.9 kbp

63 BglII BamHI BglII 0,57kbp KpnI 0,8 kbp1,5 kbp 1,6 kbp ctiT1 N-terminal region ctiT1 N-terminal region

64 DOT-T1E-P4 Ácido graso Condiciones de crecimiento LBLB más heptano C14:0 C16:1,9 cis C16:1,9 trans C16:0 C17:ciclopropano C18:2 C18:1,9 cis ol C18:1,11 cis vac C18:1,11 trans vac C18:0 2 5 0 44 27 1 16 0 2 1 10 0 46 4 1 3 26 0 8

65 0246810 12 0.2 0.4 0.6 0.8 Tiempo (horas) Turbidez (OD 660nm)

66 metH ctiT1 phoA SacIKpnIBamHIHindIII A B 0 1 2 246810 0 4 8 12 Turbidez (OD 660nm) Tiempo (horas)  mpNP/min/Turbidez (OD 660nm)

67 TIEMPO (min) 8 6 4 2 SUPERVIVENCIA (log UFC/ml) DOT-T1E DOT-T1E-109

68 213-222 YTSGSSGVLK YTGGTTGVAK E. coli P. putida. DOT-T1E ATP/AMP binding site 1 ATP/AMP binding site 2 352-357 GYGAGE GYGLTE NGWLHTGDIAVMDEEGFLRIVDRKK DGYYLTGDLATVDEQGYVFIVDRKK E. coli P. putida DOT-T1E Fatty Acid binding site (FACS signature motif) TtgJ 434-458 1 565

69

70 LB+Tolueno LB

71 Silvestre P tgA :lacZ 50 70 P tgD :lacZ 0 5 P tgG :lacZ 400 1000 DOT-T1E-109 P tgA :lacZ 50 70 P tgD :lacZ 225 1600 Cepa Fusion Unidades Miller P tgG :lacZ 1100 3750 Sin toluenoCon tolueno

72 rpfGlysS rpfA rpfB rpfF rpfCrpfH prfB rpfD recJ rpfE greA enoyl-CoA hydratase rpfA: aconitase rpfB: long chain fatty acyl CoA ligase rpfF: rpfC/rpfG: rpfH: putative regulator “two component” sensor regulator pair Physiological/environmental influences Lipid biosynthetic or catabolic pool Fatty acyl CoA RpfF RpfB FA-X X Gene regulation DSF X ?

73 Funciones inesperadas 1.-Reparación de membranas 2.- Implicación de los flagelos

74 (c) (d) 12 3 123 123 240 bp 1 220 bp 240 bp (c) (d) 12 3 240 bp 325 bp 240 bp 123 DOT-T1EDOT-T1E-42 123 240 bp 1 220 bp 2 3 240 bp DOT-T1EDOT-T1E-PS23 fliKfliLfliMfliN fliO fliP fliRflhB fliQ 1Kb fliKfliLfliMfliN fliO fliP fliRflhB fliQ (a) 1Kb orf563 DOT-T1E DOT-T1E-42 DOT-T1E-PS23 +++++ + + + + - + + + + n.d. (b) fliK-fliL fliL-fliM fliN-fliOfliO-fliP fliM-fliN fliP-fliQ fliQ-fliR fliR-flhB +++++ + + + + - + + + + n.d. + + + (b) - - - BamHI

75 8 6 4 2 SUPERVIVENCIA (log UFC/ml) TIEMPO (min) AB D 8 6 4 2 C DOT-T1E 03060 03060 FliP- FlhB-FliL-

76 log CFU 10 5 0 0 204060 DOT-T1E (wild-type) time (minutes)

77 KT2440 DOT-T1E 16 hs. 48 hs.

78

79 LB solid--LB liq. 0,3%tol LB solid--LB liq.l LB soft--LB liq. 0.3%tol LB soft--LB liq. 10 5 0 0 204060 Log CFU Time (minutes) DOT-T1E (2 days) Time (minutes) 10 5 0 0 204060 Log CFU DOT-T1E (1 day) LB--LB LB--0,3%tol LB(g)--LB(g) LB(g)--0,3%tol 10 5 0 0 204060 Time (minutes) Log CFU DOT-T1E

80 10Gs (truncated protein) 11Gs (protein + 1aa) LB--LB liq. 0,3%tol LB--LB liql LB--LB liq. 0.3%tol LB--LB liq. 10Gs 11Gs 10 5 0 0 204060 Log CFU Time (minutes)

81 FlhB - Motility Toluene tolerance DOT-T1E pMCS5-flhB 2440 pMCS5-flhB T1E + - -- pMCS5-flhB 2440 pMCS5-flhB T1E + - --

82 KT-2440 DOT-T1E