BIOINFORMATICA APLICADA A LAS CIENCIAS BIOLÓGICAS Y BIOMÉDICAS PROYECTO DE EXTENSIÓN Nº 1410 Dirección de Extensión UA FACULTAD DE CIENCIAS DE LA SALUD.

1 BIOINFORMATICA APLICADA A LAS CIENCIAS BIOLÓGICAS Y BIO...
Author: Curro Vargas
0 downloads 0 Views

1 BIOINFORMATICA APLICADA A LAS CIENCIAS BIOLÓGICAS Y BIOMÉDICAS PROYECTO DE EXTENSIÓN Nº 1410 Dirección de Extensión UA FACULTAD DE CIENCIAS DE LA SALUD DEPARTAMENTO DE TECNOLOGIA MÉDICA Y FACULTAD DE CIENCIAS BASICAS DEPARTAMENTO DE MATEMATICAS 5 - 9 JULIO 2010, Universidad de Antofagasta. Antofagasta Charla inaugural: mutación y evolución en 20 años (casi, en estricto rigor 21 años) Eliseo Martínez H.

2 gnome genome En una ceremonia de entrega de las Medallas Nacionales de Ciencia y Técnica, celebrada en la Sala Oriental de la Casa Blanca, Bush expuso con orgullo todo lo que su gobierno y el de su predecesor Reagan habían hecho por la ciencia: la estación espacial, el (ahora difunto) Supercolisionador superconductor y la iniciativa del "Gnomo" (en inglés gnome) humano. No hizo ademán alguno de rectificar. Nadie pestañeó. No se produjo en la sala ni una sonrisa disimulada ni un murmullo… 1989

3 gEnome 26 de junio de 2001

4

5

6 La Biblioteca de Alejandría

7

8

9 BIOINFORMATICA APLICADA A LAS CIENCIAS BIOLÓGICAS Y BIOMÉDICAS FACULTAD DE CIENCIAS DE LA SALUD DEPARTAMENTO DE TECNOLOGIA MÉDICA Y FACULTAD DE CIENCIAS BASICAS DEPARTAMENTO DE MATEMATICAS 5 - 9 JULIO 2010, Universidad de Antofagasta. Antofagasta Charla inaugural: mutación y evolución (solo necesitamos la multiplicación) Eliseo Martínez H. PROYECTO DE EXTENSIÓN Nº 1410 Dirección de Extensión UA

10 …the average mutation rate for eukaryotes in general is estimated to be about 2.2 x 10 -9 mutations per base pair per year (1). (1). Sudhir Kumar, Sankar Subramanian, Mutation Rates in Mammalian Genomes, PNAS, January 22, 2002, Vol. 99, No. 2, p. 803-808. (www.pnas.org/cgi/doi/10.1073/pnas.022629899 )www.pnas.org/cgi/doi/10.1073/pnas.022629899 DNA Mutation Rates and Evolution With a 20 year average generation time for humans, this works out to be around 4.4 x 10 -8 mutations per base pair per generation. Entonces la tasa de mutación de una doble hebra de longitud de 50.000 pb es de = 0.00011 mutaciones por año 20 años = 4.4*10 -8 mutaciones por pares de bases por generación 50.000 pb

11 Since most estimates of the size of the diploid human genome run around 6.3 billion base pairs, this mutation rate would give the average child around 277 mutational differences from his or her parents = …TTACTTTTACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG… … TTAGTTTAACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG… En promedio habrá 277 diferencias en el texto del genoma entre el hijo y su padre o madre This sounds like quite a high number and it is in fact on the high end of the spectrum when compared to studies looking more specifically at human mutation rates verses eukaryotic mutation rates in general. 277 mutaciones de generación en genación es una cota superior respecto de otros estudios

12 Using (…) sequence comparisons, "The average mutation rate was estimated to be ~2.5 x 10 -8 mutations per nucleotide site per generation or 175 mutations per diploid genome per generation" [Based on a higher diploid genome estimate of 7 billion base pairs]. (2) (2). Nuchman, Michael W., Crowell, Susan L., Estimate of the Mutation Rate per Nucleotide in Humans, Genetics, September 2000, 156: 297-304 (http://www.genetics.org/cgi/content/full/156/1/297? )http://www.genetics.org/cgi/content/full/156/1/297? = En promedio habrá 175 diferencias en el texto del genoma entre el hijo y su padre o madre …TTACTTTTACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG… … TTAGTTTAACCACAAGCGCGCGCGCTAATAGCGCTAGCTAG…

13 In the illustration (3) below, notice that from fertilization to the formation of a woman's first functional gamete, it takes about 23 mitotic divisions. Men, on the other hand, contribute about twice as many germ line mutations as women do. (4) At least part of the reason is that their stem cells keep dividing so that the older a man gets before having children more mitotic divisions occur. (3) http://www.nature.com/cgi- taf/DynaPage.taf?file=/nrg/journal/v1/n1/full/nrg1000_04 0a_fs.html http://www.nature.com/cgi- taf/DynaPage.taf?file=/nrg/journal/v1/n1/full/nrg1000_04 0a_fs.html (4) http://www.ornl.gov/hgmis/project/info.html http://www.ornl.gov/hgmis/project/info.html These non-direct mutation rate estimates might actually seem reasonable given that they seem to match the error rates of DNA replication that occur between the formation of a zygote in one generation and the formation of a zygote in the next generation

14 Now, consider that each diploid fertilized zygote contains around 6 billion base pairs of DNA (~3 billion from each gamete/parent, using a conservative round number). (5) From cell division to cell division, the error rate for DNA polymerase combined with other repair enzymes is about 1 mistake in 1 billion base pairs copied. (6) At this rate, there are about 6 mistakes with each diploid cell replication event. With a male/female average of 29 mitotic divisions before the production of the next generation, this works out to be about 175 mutations per generation. (5) http://www.bgsu.edu/departments/chem/midden/chem308/slides/DNARBW.pdfhttp://www.bgsu.edu/departments/chem/midden/chem308/slides/DNARBW.pdf (6) http://info.bio.cmu.edu/courses/03231/LecF02/Lec18/lec18.htmlhttp://info.bio.cmu.edu/courses/03231/LecF02/Lec18/lec18.html Meiosis de la mujer Meiosis del hombre Aprox. 6 billones de pb. Un error (aprox.) por cada billón de pb. 220 millones pb 6 errores (aprox.) en la replicación 29 meiosis antes de la producción de la nueva generación Casi 175 mutaciones por generación Un error (aprox.) por cada 10 billones de pb (7) Casi 17 mutaciones por generación (7) http://www.blc.arizona.edu/marty/411/Modules/mod6.htmlhttp://www.blc.arizona.edu/marty/411/Modules/mod6.html

15 Imperfección y evolución Si las mutaciones son benéficas para la especie y son primadas por la selección natural, se extenderán por la población, quedando perennizado el error inicial que se convertirá así en la nueva norma. La selección natural actúa sobre caracteres surgidos por azar tras mutaciones fortuitas. Los errores de la duplicación genética constituyen los procesos básicos de la evolución. Todas las realizaciones de la materia viva que observamos hoy y todas las que han existido en el pasado, del vegetal al animal, de la bacteria a la inteligencia humana, pasando por las flores más llamativas, o los dinosaurios más espectaculares, han sido frutos de imperfecciones en el funcionamiento genético. Sin ellas, la vida no hubiera podido evolucionar y hubiera permanecido en un mismo estadio primitivo, en el que unas mismas moléculas se reproducirían idéntica y perpetuamente. Louis de Bonis. Universidad de Poitiers Investigación y Ciencia, octubre de 1994

16

17 MT-Polimerasa Un estudiante preguntó: “¿esta máquina no se equivoca nunca?”. No, fue mi respuesta. En efecto, por larguísima que sea la hebra de ADN esta máquina encontrará (sin razonamiento alguno) la hebra complementaria. Epílogo: Con mucha fortuna la enzima polimerasa, junto a las enzimas que le colaboran, se equivoca… (muy poco, pero lo suficiente para seguir siendo la “especie elegida”)