1 Biol 3300 Objectives for GenomicsStudents will be able to describe map-based and whole genome sequencing approaches explain how genetic and physical chromosome maps are prepared access and use genetic information from public databases, given a particular problem in biotechnology, medicine, or biology
2 Lecture Outline Three types of maps associated with the genomeCytogenetic mapping Banding pattern In situ hybridization—FISH and chromosome painting Linkage mapping (create a genetic map) Physical mapping Types of molecular markers RFLP AFLP Minisatellites and microsatellites SNPs STS Molecular markers can be mapped Linkage mapping LOD mapping in human genetics Methods of Physical mapping Creating a contig Examples of vectors that can take large chromosomal DNA fragments Early sequencing strategies An example of 2nd generation sequencing--
3
4 Genomics--the study of the entire genome (not just one gene at a time)
6 Three types of maps associated with the GenomeCytogenetic map: sc (1A8) w (3B6) A B C D E F A B C D E F A B C D E F A B C 1 1 2 2 3 3 4 Linkage map: s c w 1.5 mu Results from each type of mapping technique may be slightly different Physical map: w sc ~ 2.4 x 106 bp Brooker, Figure 21.1 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
7 For cytogenetic mapping: fluorescence in situ hybridization (FISH)
8 For cytogenetic mapping: fluorescence in situ hybridization (FISH)Sister chromatids Treat cells with agents that make them swell and fixes them onto slide. Hybridized probe Denature chromosomal DNA. Denatured DNA (not in a double- helix form) Add single-stranded DNA probes that have biotin incorporated into them. Add fluorescently labeled avidin, which binds to biotin. Fluorescent molecule bound to probe View with a fluorescence microscope. Brooker, Figure 21.2 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
9 RFLP Analysis of different individuals(molecular marker for genetic and physical mapping) RFLP Analysis of different individuals Individual 1 EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI Homozygous for polymorphic EcoR1 site 2000 bp 5000 bp 1500 bp 3000 bp 2500 bp EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI 2000 bp 5000 bp 1500 bp 3000 bp 2500 bp Individual 2 EcoRI EcoRI EcoRI EcoRI EcoRI Homozygous for loss of EcoR1 site 2000 bp 5000 bp 4500 bp 2500 bp EcoRI EcoRI EcoRI EcoRI EcoRI 2000 bp 5000 bp 4500 bp 2500 bp Brooker Fig 21.4 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
10 Heterozygous for polymorphic EcoR1 site(molecular marker for genetic and physical mapping) RFLP Analysis, cont. EcoRI EcoRI EcoRI EcoRI EcoRI EcoRI Individual 3 Heterozygous for polymorphic EcoR1 site 2000 bp 5000 bp 1500 bp 3000 bp 2500 bp EcoRI EcoRI EcoRI EcoRI EcoRI 2000 bp 5000 bp 4500 bp 2500 bp Cut the DNA from all 3 individuals with EcoRI. Separate the DNA fragments by gel electrophoresis. (Most restriction sites are shared in the population if restriction segments are found in 99% of individuals then it is considered monomorphic.) 1 2 3 5000 bp 4500 bp Polymorphic bands indicated at arrows. 3000 bp 2500 bp 2000 bp 1500 bp Brooker, Fig 21.4 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
11 Southern Blot only shows the polymorphic band(molecular marker for genetic and physical mapping) Southern Blot only shows the polymorphic band Probe must bind to a polymorphic site Figure not in Brooker
12 SNP variation—Single Nucleotide Polymorphisms(molecular marker for genetic and physical mapping) SNP variation—Single Nucleotide Polymorphisms
13 Microsatellites (or Short Tandem Repeats--STR)(molecular marker for genetic and physical mapping) Microsatellites (or Short Tandem Repeats--STR) CA = (CA)1 CACACACACA = (CA)5 CACACACACACACACACACACACACACA = (CA)14 2 bp repeat TTTTC = (TTTTC)1 TTTTCTTTTCTTTTC = (TTTTC)3 TTTTCTTTTCTTTTCTTTTCTTTTCTTTTC = (TTTTC)5 5 bp repeat
14 The same forward and reverse primers PCR-amplify different allele lengths for a microsatellite5’GGGAAA3’ (CA)1 allele 5’-…gggaaacctgCAtcgtgccagctg…-3’ (CA)5 allele 5’-…gggaaacctgCACACACACAtcgtgccagctg…-3” (CA)8 allele 5’-…cgggaaacctgCACACACACACACACAtcgtgccagctg…-3’ 3’GTCGAC5’ 5’GGGAAA3’ 3’GTCGAC5’ 5’GGGAAA3’ 3’GTCGAC5’
15 PCR of microsatellites(molecular marker for genetic and physical mapping) PCR of microsatellites Set of chromosomes Add PCR primers specific to polymorphic chromosome 2 STR 2 2 Many cycles of PCR produce a large amount of DNA fragment between the 2 primers. (CA)10 allele Gel electrophoresis Brooker, Fig 21.5 (CA)5 allele
16 Electrophoretic gel of polymorphic microsatellite found in family (PCR amplified)Parents Sue Henry Offspring Mary Joelle Hank Sue Henry Mary Joelle Hank 154 150 Fragment length (bp) 146 140 Brooker, Fig 20.12 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
17 RFLPs (and other markers) can be mapped16 recombinants/100 total offspring 16 mu Figure not in Brooker
18 Using markers to map BRCA2 gene in humansSequence of BRCA2 Wooster et al., 1995 Fig from Wooster et al., 1995
19 In human genetics, computer algorithms are used to determine linkageThe likelihood of linkage between two markers is determined by the lod (logarithm of the odds) score method Computer programs analyze pooled data from a large number of pedigrees or crosses involving many markers They determine probabilities that are used to calculate the lod score lod score = log10 Probability of a certain degree of linkage Probability of independent assortment Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
20 Numbers denote chromosome order of clonesPhysical Mapping A B C D E F GH I J K L M NO P Q R Clone individual chromosome pieces into vectors A B C D F GH J NO I K M P 1 3 5 7 9 Vector Collection of ordered, overlapping clones (contig) B C D E F GH I K L Q M P R 2 4 6 8 1 Numbers denote chromosome order of clones Booker, fig 21.7 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
21 Examples of different types of vectors and host organismsGenome of Interest Host Organism Vector Size of Insert Human genome Yeast YAC (Yeast Artificial Chromosome) kb Worm (nematode) genome Bacteria Cosmid < 45 kb Firefly genome Virus l phage < 20 kb Drosophila genome Plasmid < 15 kb
22 Yeast Artificial ChromosomesARS (yeast origin of replication) CEN (yeast centromere) EcoRI site Chromosomal DNA ORI (E.coli origin of replication) Selectable Marker gene Selectable marker gene TEL TEL (yeast telomere) BamHI site BamHI site Cut (occasionally) with low concentration of EcoRI to yield very large fragments. Cut with EcoRI and BamHI. Each arm has a different selectable marker. Therefore, it is possible to select for yeast cells with YACs that have both arms Left arm + Right arm + Fragment not needed in yeast Mix and add DNA ligase. Yeast artificial chromosome (YAC) TEL Selectable marker gene ORI CEN ARS Large piece of chromosomal DNA Selectable marker gene TEL Note: not drawn to scale. Chromosomal DNA is much larger than the YAC vector. Brooker, Fig 21.9
23 Bacterial Artificial ChromosomeCopyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. lacZ cm R HindIII BamHI SphI Bacterial Artificial Chromosome parC parB repE parA oriS
24 Which clones will the green probe detect? The red probe?K L M A B C D F GH J NO I K M P 1 3 5 7 9 Vector B C D E GH I K L Q F M P R 2 4 6 8 1 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
25 Which clones will the green probe detect? The red probe?K L M A B C D F GH J NO I K M P 1 3 5 7 9 Vector B C D E GH I K L Q F M P R 2 4 6 8 1 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
26 Linking the genetic map to physical mapRegion of chromosome 11 Gene A Gene B 1.5 mu Gene A Gene B 1 2 3 4 5 6 7 Genes A and B mapped previously to specific regions of chromosome 11 Gene A was found in the insert of clone #2 Gene B was found in the insert of clone #7 So Genes A and B can be used as reference points to align the members of the contig Figure 21.8 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
27 Gene B Gene A 1 2 3 4 5 . n Numbers indicate regions that are subcloned. Gene B (Starting clone) Cosmid vector The number of steps required to reach the gene of interest depends on the distance between the start and end points Subclone*. (with radiolabeled nucleotides) Screen a library. 1 2 (Second clone) Subclone*. 2 Screen a library. 2 3 (Third clone) Repeat subcloning and screening until gene A is reached. Gene A n Figure 20.18 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
28 Brooker, Fig 21.14 (a) Hierarchical genome shotgun sequencingIsolate chromosomal DNA Isolate chromosomal DNA Clone large chromosomal DNA fragments into BACs and create a contig for each chromosome. Shear DNA into small and large pieces. Clone chromosomal DNA pieces into vectors. BAC vector Vector BAC contig Chromosomal DNA Chromosomal DNA For each BAC, shear into smaller pieces and clone DNA pieces into vectors. Vector Clones from one BAC insert: Chromosomal DNA Determine the chromosomal DNA sequence, usually at both ends, by shotgun sequencing. The results below show sequences of three chromosomal DNA clones. From the clones of each BAC, determine the chromosomal DNA sequence, usually at one end, by shotgun sequencing. The results below show the sequences from three chromosomal DNA clones. T T A C C G G T A G G C A C C T C C G A C C T T A C C G A C C A C A C C T G T T A C G G G T C G A C C A C C C G A T T A A T G G G T C A A A C C T A G G T T A A T C G C G A A T T G Based on overlapping regions, create one contiguous sequence. Based on overlapping regions, create one contiguous sequence. C C G A C C T T A C C G A C C A C C C G A T T A A T C G C G A A T T G T T A C C G G T A G G C A C C T G T T A C G G G T C A A A C C T A G G (a) Hierarchical genome shotgun sequencing (b) Whole-genome shotgun sequencing Brooker, Fig 21.14
29
30 Isolate genomic DNA and break into fragments. Deposit the beads into a picotiter plate. Only one bead can fit into each well. Fragment of genomic DNA Covalently attach oligonucleotide adaptors to the 5′ and 3′ ends of the DNA. Adaptors Denature the DNA into single strands and attach to beads via the adaptors. Note: Only one DNA strand is attached to a bead. Add sequencing reagents: DNA polymerase, primers, ATP sulfurylase, luciferase, apyrase, adenosine 5′ phosphosulfate, and luciferin. Sequentially flow solutions containing A, T, G, or C into the wells. In the example below, T has been added to the wells. PPi (pyrophosphate) is released when T is incorporated into the growing strand. T T C A T G C A Primer PPi + Adenosine 5′ phosphosulfate ATP sulfurylase ATP + luciferin Luciferase Light Emulsify the beads so there is only one bead per droplet. The droplets also contain PCR reagents that amplify the DNA. Light is detected by a camera in the sequencing machine. Brooker, Fig 21.15 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
31 Linking all the maps Brooker, Fig 21.11 Cytogenetic map Linkage mapChromosome 16 95 million bp Cytogenetic map (resolution of in situ hybridization 3–5 megabases) p q Low resolution (3–5 million bp) * 13.2 13.2 13.13 13.12 13.11 12.3 12.2 12.1 11.2 11.1 11.2 12.1 12.2 13.0 21.0 22.1 22.2 22.3 23.1 23.2 23.3 24.1 24.2 24.3 Linkage map (resolution 3–5 cM; not all linkage markers are shown) D16S85 D16S60 D16S159 D16S48 D16AC6.5 D16S150 D16S149 D16S160 D16S40 D16S144 * 500 times expansion YAC N16Y1 150,000 bp * 310C4 N16Y1-29 = (GT)n Physical map of overlapping cosmid clones (resolution 5–10 kilobases) N16Y1-18 N16Y1-13 N16Y1-14 N16Y1-12 N16Y1-16 N16Y1-30 Cosmid contig 211 5F3 312F1 309G11 High resolution (1–100,000 bp) N16Y1-19 N16Y1-10 * STS N16Y1-10 Primer 3′ AGTCAAACGTTTCCGGCCTA 5′ 5′ GATCAAGGCGTTACATGA TCAGTTTGCAAAGGCCGGAT 3′ Sequence-tagged site (resolution 1 base) 3′ CTAGTTCCGCAATGTACT AGTCAAACGTTTCCGGCCTA 5′ 5′ — GATCAAGGCGTTACATGA — 3′ Primer 219 bp Brooker, Fig 21.11 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.