CSC 421: Algorithm Design and Analysis

1 CSC 421: Algorithm Design and AnalysisSpring 2016 Brute...
Author: 侵庸 谈
0 downloads 1 Views

1 CSC 421: Algorithm Design and AnalysisSpring 2016 Brute force approach & efficiency invoices example KISS vs. generality exhaustive search: string matching generate & test: N-queens, TSP, Knapsack inheritance & efficiency ArrayList  SortedArrayList

2 HW1 from a previous semester

3 Top-level design read in invoice data from file store thempublic class TotalSales1 { public static void main(String[] args) { ArrayList invoices = new ArrayList(); System.out.print("Enter the sales file name: "); Scanner input = new Scanner(System.in); String filename = input.next(); try { int totalUnits = 0; double totalSales = 0.0; Scanner infile = new Scanner(new File(filename)); while (infile.hasNext()) { String date = infile.next(); String customer = infile.next(); int units = infile.nextInt(); double price = infile.nextDouble(); String salesPerson = infile.next(); String newInvoice = date+" "+customer+" "+units+" "+price+" "+salesPerson; TotalSales1.addInOrder(invoices, newInvoice); totalUnits += units; totalSales += units * price; } infile.close(); System.out.println(); for (String nextInvoice : invoices) { System.out.println(nextInvoice); System.out.println("Total units = " + totalUnits); System.out.println("Total sales = $" + totalSales); catch (java.io.FileNotFoundException e) { System.out.println("Sales file not found."); input.close(); Top-level design read in invoice data from file store them calculate total units & sales display the invoices, SORTED BY DATE, and the totals

4 (Ugly) helper methods this brute force approach requires adding the invoices in order (or sorting) which requires writing a method to compare dates (or using a Java library class) private static void addInOrder(ArrayList invoices, String newInvoice) { invoices.add(newInvoice); int index = invoices.size()-1; while (index > 0 && TotalSales1.comesBefore(invoices.get(index).split(" ")[0], invoices.get(index-1).split(" ")[0])) { invoices.set(index, invoices.get(index-1)); invoices.set(index-1, newInvoice); index--; } private static boolean comesBefore(String date1, String date2) { String dateParts1[] = date1.split("-"); String dateParts2[] = date2.split("-"); if (Integer.parseInt(dateParts1[2]) != Integer.parseInt(dateParts2[2])) { return Integer.parseInt(dateParts1[2]) < Integer.parseInt(dateParts2[2]); else if (Integer.parseInt(dateParts1[0]) != Integer.parseInt(dateParts2[0])) { return Integer.parseInt(dateParts1[0]) < Integer.parseInt(dateParts2[0]); else { return Integer.parseInt(dateParts1[1]) < Integer.parseInt(dateParts2[1]);

5 More OO version OO philosophy: identify objects that can be modeled with code implement and test them separately, can then be reused Invoice class was provided – modify it to implement Comparable public class Invoice implements Comparable { // FIELDS, CONSTRUCTORS & METHODS AS PROVIDED IN ASSIGNMENT public int compareTo(Invoice other) { String[] thisParts = this.getDate().split("-"); String[] otherParts = other.getDate().split("-"); if (!thisParts[2].equals(otherParts[2])) { return Integer.parseInt(thisParts[2]) - Integer.parseInt(otherParts[2]); } else if (!thisParts[0].equals(otherParts[0])) { return Integer.parseInt(thisParts[0]) - Integer.parseInt(otherParts[0]); else if (!thisParts[1].equals(otherParts[1])) { return Integer.parseInt(thisParts[1]) - Integer.parseInt(otherParts[1]); else { String thisExtra = this.getCustomerID()+" "+this.getSalesPerson(); String otherExtra = other.getCustomerID()+" "+other.getSalesPerson(); return thisExtra.compareTo(otherExtra); WHY THE ELSE CASE?

6 More OO version (cont.) CLEANER: uses a TreeSet to order the Invoicespublic class TotalSales2 { public static void main(String[] args) { TreeSet invoices = new TreeSet(); System.out.print("Enter the sales file name: "); Scanner input = new Scanner(System.in); String filename = input.next(); try { int totalUnits = 0; double totalSales = 0.0; Scanner infile = new Scanner(new File(filename)); while (infile.hasNext()) { Invoice inv = new Invoice(infile); invoices.add(inv); totalUnits += inv.getUnits(); totalSales += inv.getUnits() * inv.getPricePerUnit(); } infile.close(); System.out.println(); for (Invoice i : invoices) { System.out.println(i); System.out.println("Total units = " + totalUnits); System.out.println("Total sales = $" + totalSales); catch (java.io.FileNotFoundException e) { System.out.println("Sales file not found."); input.close(); CLEANER: I/O and comparison details are hidden uses a TreeSet to order the Invoices explains the else case can't have duplicates could have used a List call Collections.sort once all Invoices have been added

7 Even more OO version would be even better to remove the Set/List details create an InvoiceList class that you can add Invoices to and access as needed public class InvoiceList { private Set invoices; private int totalUnits; private double totalSales; public InvoiceList() { this.invoices = new TreeSet(); this.totalUnits = 0; this.totalSales = 0.0; } public void add(Invoice inv) { this.invoices.add(inv); this.totalUnits += inv.getUnits(); this.totalSales += inv.getUnits() * inv.getPricePerUnit(); public String toString() { String invStr = ""; for (Invoice inv : invoices) { invStr += inv + "\n"; return invStr + "Total units = " + totalUnits + "\n" + "Total sales = $" + totalSales; a truly useful class would have other methods, e.g., getters & setters

8 Even more OO version (cont.)CLEANEST: data structure choices are hidden – could be changed without affecting main all I/O is contained in the driver – could be changed without affecting classes is it worth the effort? v.2 definitely! v.3 yes if reuse is possible public class TotalSales3 { public static void main(String[] args) { InvoiceList invoices = new InvoiceList(); System.out.print("Enter the sales file name: "); Scanner input = new Scanner(System.in); String filename = input.next(); try { Scanner infile = new Scanner(new File(filename)); while (infile.hasNext()) { Invoice inv = new Invoice(infile); invoices.add(inv); } infile.close(); System.out.println(invoices); catch (java.io.FileNotFoundException e) { System.out.println("Sales file not found."); input.close();

9 Brute force many problems do not require complex, clever algorithmsa brute force (i.e., straightforward) approach may suffice consider the exponentiation application simple, iterative version: ab = a * a * a * … * a (b times) recursive version: ab = ab/2 * ab/2 while the recursive version is more efficient, O(log N) vs. O(N), is it really worth it? brute force works fine when the problem size is small only a few instances of the problem need to be solved need to build a prototype to study the problem

10 Exhaustive search: string matchingconsider the task of the String indexOf method find the first occurrence of a desired substring in a string this problem occurs in many application areas, e.g., DNA sequencing CGGTAGCTTGCCTAGGAGGCTTCTCATAGAGCTCGATCGGTACG… TAGAG

11 Exhaustive string matchingthe brute force/exhaustive approach is to sequentially search CGGTAGCTTGCCTAGGAGGCTTCTCATAGAGCTCGATCGGTACG… public static int indexOf(String seq, String desired) { for (int start = 0; start <= seq.length() – desired.length(); start++) { String sub = seq.substring(start, start+desired.length()); if (sub.equals(desired)) { return start; } return -1; efficiency of search? we can do better (more later) – do we need to?

12 Generate & test sometimes exhaustive algorithms are referred to as "generate & test" can express algorithm as generating each candidate solution systematically, testing each to see if the candidate is actually a solution string matching: try seq.substring(0, desired.length()) if no match, try seq.substring(1, desired.length()+1) if no match, try seq.substring(2, desired.length()+2) … extreme (and extremely bad) example – permu-sort to sort a list of items, generate every permutation and test to see if in order efficiency?

13 Generate & test: N-queensgiven an NxN chess board, place a queen on each row so that no queen is in jeopardy generate & test approach systematically generate every possible arrangement test each one to see if it is a valid solution this will work (in theory), but the size of the search space may be prohibitive 4x4 board  8x8 board  = 1,820 arrangements again, we can do better (more later) 4! = 24 arrangements = 131,198,072 arrangements 8! = 40,320 arrangements

14 nP-hard problems: traveling salesmanthere are some problems for which there is no known "efficient" algorithm (i.e., nothing polynomial)  known as nP-hard problems (more later) generate & test may be the only option Traveling Salesman Problem: A salesman must make a complete tour of a given set of cities (no city visited twice except start/end city) such that the total distance traveled is minimized. example: find the shortest tour given this map generate & test  try every possible route efficiency?

15 xkcd: Traveling Salesman Problem comica dynamic programming approach (more later) can improve performance slightly, but still intractable for reasonably large N

16 nP-hard problems: knapsack problemanother nP-hard problem: Knapsack Problem: Given N items of known weights w1,…,wN and values v1,…,vN and a knapsack of capacity W, find the highest-value subset of items that fit in the knapsack. example: suppose a knapsack with capacity of 50 lb. Which items do you take? tiara $ lbs coin collection $ lbs HDTV $ lbs laptop $ lbs silverware $ lbs stereo $ lbs PDA $ lb clock $ lbs generate & test solution: try every subset & select the one with greatest value

17 Dictionary revisited recall the Dictionary class earlierimport java.util.List; import java.util.ArrayList; import java.util.Scanner; import java.io.File; public class Dictionary { private List words; public Dictionary() { this.words = new ArrayList(); } public Dictionary(String filename) { this(); try { Scanner infile = new Scanner(new File(filename)); while (infile.hasNext()) { String nextWord = infile.next(); this.words.add(nextWord.toLowerCase()); catch (java.io.FileNotFoundException e) { System.out.println("FILE NOT FOUND"); public void add(String newWord) { this.words.add(newWord.toLowerCase()); public void remove(String oldWord) { this.words.remove(oldWord.toLowerCase()); public boolean contains(String testWord) { return this.words.contains(testWord.toLowerCase()); recall the Dictionary class earlier the ArrayList add method simply appends the item at the end  O(1) the ArrayList contains method performs sequential search  O(N) this is OK if we are doing lots of adds and few searches

18 StopWatch public class StopWatch { private long lastStart; private long lastElapsed; private long totalElapsed; public StopWatch() { this.reset(); } public void start() { this.lastStart = System.currentTimeMillis(); public void stop() { long stopTime = System.currentTimeMillis(); if (this.lastStart != -1) { this.lastElapsed = stopTime - this.lastStart; this.totalElapsed += this.lastElapsed; this.lastStart = -1; public long getElapsedTime() { return this.lastElapsed; public long getTotalElapsedTime() { return this.totalElapsed; public void reset() { this.lastElapsed = 0; this.totalElapsed = 0; big-Oh analysis is good for understanding long-term growth sometimes, you want absolute timings to compare algorithm performance on real data

19 Timing dictionary searcheswe can use our StopWatch class to verify the O(N) efficiency dict. size build time 38, msec 77, msec 144, msec dict. size search time 38, msec 77, msec 144, msec execution time roughly doubles as dictionary size doubles import java.util.Scanner; import java.io.File; public class DictionaryTimer { public static void main(String[] args) { System.out.println("Enter name of dictionary file:"); Scanner input = new Scanner(System.in); String dictFile = input.next(); StopWatch timer = new StopWatch(); timer.start(); Dictionary dict = new Dictionary(dictFile); timer.stop(); System.out.println(timer.getElapsedTime()); for (int i = 0; i < 100; i++) { dict.contains("zzyzyba"); } System.out.println(timer.getElapsedTime()/100.0);

20 Sorting the list if searches were common, then we might want to make use of binary search this requires sorting the words first, however we could change the Dictionary class to do the sorting and searching a more general solution would be to extend the ArrayList class to SortedArrayList could then be used in any application that called for a sorted list recall: public class java.util.ArrayList implements List { public ArrayList() { … } public boolean add(E item) { … } public void add(int index, E item) { … } public E get(int index) { … } public E set(int index, E item) { … } public int indexOf(Object item) { … } public boolean contains(Object item) { … } public boolean remove(Object item) { … } public E remove(int index) { … } }

21 SortedArrayList (v.1) using inheritance, we only need to redefine what is new add method sorts after adding; indexOf uses binary search no additional fields required big-Oh for add? big-Oh for indexOf? import java.util.ArrayList; import java.util.Collections; public class SortedArrayList> extends ArrayList { public SortedArrayList() { super(); } public boolean add(E item) { super.add(item); Collections.sort(this); return true; public int indexOf(Object item) { return Collections.binarySearch(this, (E)item);

22 SortedArrayList (v.2) is this version any better? when?big-Oh for add? big-Oh for indexOf? import java.util.ArrayList; import java.util.Collections; public class SortedArrayList> extends ArrayList { public SortedArrayList() { super(); } public boolean add(E item) { // NOTE: COULD REMOVE THIS METHOD AND super.add(item); // JUST INHERIT THE ADD METHOD FROM return true; // ARRAYLIST AS IS public int indexOf(Object item) { Collections.sort(this); return Collections.binarySearch(this, (E)item);

23 SortedArrayList (v.3) if insertions and searches are mixed, sorting for each insertion/search is extremely inefficient instead, could take the time to insert each item into its correct position big-Oh for add? big-Oh for indexOf? import java.util.ArrayList; import java.util.Collections; public class SortedArrayList> extends ArrayList { public SortedArrayList() { super(); } public boolean add(E item) { int i; for (i = 0; i < this.size(); i++) { if (item.compareTo(this.get(i)) < 0) { break; super.add(i, item); return true; public int indexOf(Object item) { return Collections.binarySearch(this, (E)item); search from the start vs. from the end?

24 Dictionary using SortedArrayListnote that repeated calls to add serve as insertion sort dict. size build time 38, sec 77, sec 144, sec dict. size search time 38, msec 77, msec 144, msec build time roughly quadruples as dictionary size doubles; search time is trivial import java.util.Scanner; import java.io.File; import java.util.Date; public class DictionaryTimer { public static void main(String[] args) { System.out.println("Enter name of dictionary file:"); Scanner input = new Scanner(System.in); String dictFile = input.next(); StopWatch timer = new StopWatch(); timer.start(); Dictionary dict = new Dictionary(dictFile); timer.stop(); System.out.println(timer.getElapsedTime()); for (int i = 0; i < 100; i++) { dict.contains("zzyzyba"); } System.out.println(timer.getElapsedTime()/100.0);

25 SortedArrayList (v.4) if adds tend to be done in groups (as in loading the dictionary) it might pay to perform lazy insertions & keep track of whether sorted big-Oh for add? big-Oh for indexOf? if desired, could still provide addInOrder method (as before) import java.util.ArrayList; import java.util.Collections; public class SortedArrayList> extends ArrayList { private boolean isSorted; public SortedArrayList() { super(); this.isSorted = true; } public boolean add(E item) { this.isSorted = false; return super.add(item); public int indexOf(Object item) { if (!this.isSorted) { Collections.sort(this); return Collections.binarySearch(this, (E)item);

26 Timing the lazy dictionary on searchesmodify the Dictionary class to use the lazy SortedArrayList dict. size build time 38, msec 77, msec 144, msec dict. size 1st search 38, msec 77, msec 144, msec dict. size search time 38, msec 77, msec 144, msec import java.util.Scanner; import java.io.File; import java.util.Date; public class DictionaryTimer { public static void main(String[] args) { System.out.println("Enter name of dictionary file:"); Scanner input = new Scanner(System.in); String dictFile = input.next(); StopWatch timer = new StopWatch() timer.start(); Dictionary dict = new Dictionary(dictFile); timer.stop(); System.out.println(timer.getElapsedTime()); dict.contains("zzyzyba"); for (int i = 0; i < 100; i++) { } System.out.println(timer.getElapsedTime()/100.0);