1 Dual RNA- Guided Editing of EDual RNA- Guided Editing of E. coli’s DnaB Helicase Using the CRISPR-Cas9 System Preston Jones, REU Baylor University Michael Trakselis, PhD Department of Chemistry and Biochemistry, Baylor University
2 Laboratory Aims Study mechanisms of DNA-protein interactions as relates to DNA repair mechanisms. Study mechanism of helicase unwinding. Use innovative biochemistry techniques when able.
3 Current Helicase HypothesesNo Interaction Total exclusion of one strand
4 MCM SEW Model MCM9 Family implicated in POFImage: Michael Trakselis, Ph.D “Steric Exclusion and wrapping of the excluded DNA strand occurs along discrete external binding paths during MCM helicase unwinding”
5 EcDnaB Helicase Homologous structure to MCM suggests homologous method of unwinding. The Protein Data Bank PDBID: 2R6A
6 EcDnaB SEW Model
7 CRISPR-Cas9 Immunology
8 CRISPR-Cas9 ImmunologyCas9 Cut site
9 Using CRISPR/Cas9 for Genome EditingProgram crRNA to guide cas9 to cut a desired location on genome. (Near PAM) Cell uses recombineering to take up foreign DNA for survival Design foreign DNA to introduce precise mutation in the genome In Eukaryotic systems, near 100% success rate.
10 CRISPR-Cas9 complex
11 CRISPR Targeting Jiang, et al. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nature Biotechnology. March 2013.
12 Bacterial Genome EditingCan’t have CRISPR and Cas9 in same plasmid 65% resultant colonies have desired mutation 35% ‘escape’ CRISPR cutting mechanism If possible cell will delete gene for viability (still in 35%) Cell Line: HME63 from Court Lab Utilizing lambda- red recombineering proteins
13 How to test? Design oligos that have the following:Complements to the original strand (for HR) Contains the mutation (that allows for Cas9 survival) Contains a RE site for testing successful colonies. Successful colonies should have predetermined loci for restriction enzyme cutting Makes screening simple.
14 pCRISPR Insert spacer that codes for the crRNA that complexes with tracrRNA and Cas9 for cutting.
15 pCRISPR spacer editing
16 pCRISPR cut with BsaI Lane 1 Lane 3 Lane 2 Lane 4 2kb 3kbLane 1- 2 Log Molecular Weight Lane 2- uncut pCRISPR plasmid Lane 3- pCRISPR with BsaI Lane 4- pCRISPR with BsaI
17 CRISPR TransformationKanamycin plates
18 Screening pCRISPR #1 Lane 1 Lane 2 Lane 3 Lane 5 Lane 4 Lane 6 Lane 7R74A R164A K180A R328A/ R329A 1kb Legend: 1-2 Log MW 2-7 R74A colonies 1-6 8-13 R164A colonies 1-6 14-19 K180A colonies 1-6 20- R328A/R329A colony 1
19 Screening pCRISPR #2 Legend: Lane 1 Lane 3 Lane 2 Lane 5 Lane 4 Lane 6R328A/ R329A Q384A M235L 1kb 1- 2log MW 2-6 R328A/R329A colonies 2-6 7-12 Q384A colonies 1-6 13-18 M235L colonies 1-6 19- positive control pCRISPR Negative control- no template
20 Results Moving Forward Colony PCR for screening coloniesNo RE cutting in any colony Slow screening process Phenol:Chloroform genomic prep No positive control Moving Forward Colony PCR for screening colonies Design a positive control
21 Positive Control Q384Q 5’- ACTGAACGTGCCGGTGGTGGCGCTGTCCCAATT|GAACCGTTCTCTGGAACAACGTGCCGA MfeI site R74R 5’-GTCATATCTTTACTGAAATGGCGCGC|TTGCAGGAAAGCGGTAGCCCTATCGATCTGATTA BSSHII site
22 Positive control screeningLane 2 Lane 1 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8 Lane 9 Lane 10 Lane 11 Lane 13 Lane 12 - + R74R Q384Q 4 6 5 2 1 3 RE: Colony:
23 Optimization of Recombineering StrainsHME6 HME63 HME70 SIMD90 NOTE: HME70 and SIMD90 Failed at accepting positive CRISPR (lawns) Don Court, Ph.D
24 HME6 vs New HME63 Legend: 2-log molecular weight HME 6 colony 1Lane 1 Lane 2 Lane 3 Lane 5 Lane 4 Lane 6 Lane 8 Lane 7 Lane 10 Lane 9 Lane 11 Lane 12 Lane 13 Lane 14 Lane 15 1kb .5kb HME6 HME63 100% editing efficiency
25 CRISPR success R164A R74A K180A 1.4 kb 1.0 kb 0.5 kb Lane 1 Lane 2Legend: 2-log mw R74A colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony6 R164A colony 1 Colony 6 K180A colony 1 R164A R74A K180A 1.4 kb 1.0 kb 0.5 kb Lane 1 Lane 2 Lane 3 Lane 5 Lane 4 Lane 6 Lane 8 Lane 7 Lane 9 Lane 11 Lane 10 Lane 12 Lane 13 Lane 14 Lane 15 Lane 16 Lane 18 Lane 17 Lane 19 WT- no native cuts
26 CRISPR success Q384A 1.4 kb 1.0 kb Lane 1 Lane 2 Lane 3 Lane 5 Lane 4Legend: 2-log mw Q384A colony 1 Colony 2 Colony 3 Colony 4 Colony 5 Colony 6 75% success rate of screened colonies
27 CRISPR Success K180A Legend: 2-log MW K180A colony 1 no ApaIK180A colony 1 with ApaI K180A colony 2 no ApaI K180A colony 2 with ApaI K180A colony 3 no ApaI K180A colony 3 with ApaI K180A colony 4 no ApaI K180A colony 4 with ApaI K180A colony 5 no ApaI K180A colony 5 with ApaI K180A colony 6 no ApaI K180A colony 6 with ApaI Lane 1 Lane 2 Lane 3 Lane 6 Lane 5 Lane 4 Lane 7 Lane 8 Lane 9 Lane 10 Lane 11 Lane 12 Lane 13 1 2 3 4 5 6 - + - No ApaI + ApaI Digestion 1.4 kb 1.0 kb Good for Purification
28 Separation TechniquesQ Column- anion exchanger pI of DnaB is 4.7 pH>pI negatively charged protein DnaB will stick to stationary phase Heparin column- sulfate polymer; mimics DNA Gel Filtration Column- separation based on size DnaB should elute around mL based on calibration curve
29 K180A Q Column
30 K180A Q Column Lane 2 Lane 1 Lane 4 Lane 3 Lane 5 Lane 6 Lane 8 Lane 750kDa Legend: BioRad Precision Plus Dual-Color Ladder Ammonium Sulfate Suspension Ammonium Sulfate Pellet Sus. Q Flowthrough Fraction 8 Fraction 9 Fraction 10 Fraction 11 Fraction 12 Fraction 17
31 K180A Heparin column
32 K180A Heparin Column Lane 1 Lane 3 Lane 2 Lane 5 Lane 4 Lane 6 50kDaLegend: BioRad Precision Plus Dual-Color Ladder Heparin Flowthrough Fraction 8 Fraction 9 Fraction 10 Fraction 11
33 K180A GFC
34 K180A GFC Lane 1 Lane 2 Lane 3 Lane 5 Lane 4 Lane 7 Lane 6 Lane 850kDa Legend: BioRad Precision Plus Dual-Color Ladder Fraction 2 Fraction 6 Fraction 10 Fraction 13 Fraction 17 Fraction 23 Fraction 36 Fraction 44 Fraction 45
35 Other Summer PurificationsIn vitro site-directed mutagenesis produced 2 positive mutations R278A and K373A These were both purified using the same separation techniques as K180A
36 Conclusions/ Future directions3 purified EcDnaB mutants ready for assays. Assay mutants to see if DNA unwinding kinetics are effected using smFRET Use radiolabeled DNA for unwinding assays Results used in a grant application. Future paper New technique developed for the lab (CRISPR Editing) Optimization of the CRISPR/Cas9 system in bacterial cells could mean a lot for biochemistry and genetics.
37 Thank you all! (Baylor Family)
38 Thank you all! (GRU Family)