1 Evolution of a bacterial pathogen: major strategies

2 Impatto della plasticità genomica nell’adattamento dei batteri patogeniL’acquisizione di elementi genetici mobili quali batteriofagi, plasmidi o isole genomiche contribuisce all’evoluzione dei patogeni dalle varianti commensali. Durante l’infezione, la fluidità genomica tramite riarrangiamenti, delezioni o mutazioni puntiformi determina l’insorgenza di ceppi patogeni persistenti oppure determian una down regolazione di alcuni geni .Nei ceppi persistenti si nota un accumulo di mutazioni.

3

4 Shigella is Gram negative enterobacterium is an intracellular human pathogen etiological agent of bacillary dysentery, an acute diarrheal disease 160 million of episodes1,1 million deaths/years in children and infants in developing countries. Subgrouped in: S. flexneri S. dysenteriae S. sonnei S. boydii Shigella shares a great sequence homology with E.coli (> 90%) but it is a pathogen

5 Shigella Infection is spread via fecal-oral routeis a Gram negative, facultative anaerobe is an intracellular pathogen is the etiological agent of bacillary dysentery, an acute diarrheal disease causes 160 million of episodes, determining 1.1 million deaths/year in children and infants in developing countries. Infection is spread via fecal-oral route Subgrouped into four “species”: Shigella flexneri Shigella dysenteriae Shigella boydii Shigella sonnei Shigella Due to the high level of genome homology, Shigella is now considered among E.coli

6 invasion of the colonic mucosaModel for Shigella invasion of the colonic mucosa Inflammatory cytokines cascade Bacteria Enterocytes Polymorphonuclear leucocytes M cells Galan & Sansonetti, 1996 adapted from

7

8

9

10

11

12

13 The evolutionary pathway from E.coli to Shigella: a good exampleACQUISITION pINV The major event that give rise to the Shigella /EIEC pathotype has been the acquisition of the large virulence plasmid pINV

14 pINV of Shigella contains all virulence determinantsVenkatesan et al, 2001 adapted from pINV carries necessary genes for: adhesion invasion spreading coded by spa-mxi-ipa region and icsA positive regulation of virulence genes coded by virF and virB icsA IS elements virulence genes

15 Actin filaments Nucleus IpaD IpaB, IpaC IcsA (VirG) IcsB Salyers & Whitt, 1994 adapted from pINV Proteins involved in the invasion process, as well as proteins of Type III Secretion System, are encoded by the virulence plasmid (pINV) and are expressed only at the host temperature (37°C)

16 Cross-talk between chromosomal and plasmid genespINV icsA 30°C 37°C VirF is the first plasmid transcriptonal activator of Shigella expressed at 37°C is able to positively regulate plasmid virulence genes, virB and icsA H-NS is a chromosomal global regulator negatively regulates virF and virB at 30°C Cross-talk between chromosomal and plasmid genes

17

18

19

20

21

22 Cross-talk between chromosomal and plasmid genesH-NS is a chromosomal global regulator negatively regulates virF at 30°C pINV icsA 30°C 37°C VirF is the first plasmid transcriptional activator of Shigella expressed at 37°C is able to positively regulate plasmid virulence genes, virB and icsA

23 Shi PAI iron transport toxin production adhesin synthesis Besides the acquisition of the large virulence plasmid pINV, several pathogenicity islands have been identified on the Shigella chromosome Shi PAIs carry genes that contribute to virulent life style

24 Shedding of genes which interfere with the pathogenic lifestyle ShigellaIn Shigella gene acquisition by horizontal gene transfer is counterbalanced by the loss of native genes, which may have become unnecessary or deleterious for intracellular life. SHI-1 SHI-2 Virulence plasmid nad cad Shigella (virulent) E.coli ancestor (harmless) DELETIONS ADDITIONS ompT

25

26 Patho(genicity) adaptive mutationsAntivirulence genes are eliminated through pathoadaptive mutations Patho(genicity) adaptive mutations improve bacterial fitness in new host environments drive a microrganism towards a more pathogenic lifestyle Some examples pathoadaptive mutations in Shigella: loss of cadaverine Loss of acetylspermidine Loss of surface protease OmpT Loss of ability to synthetize nicotinic acid (QUINOLATE)

27 Effect of antivirulence genes ofShigella on the invasive process.Two genetic loci involved in the synthesis of polyamines have been silenced…

28 Basic functional role of polyaminesPolyamines are small polycationic molecoles present in both, eucaryotic and prokaryotic cells.. NH3+ +H3N H2+ N Putrescin Spermidin Spermin Cadaverin Basic functional role of polyamines They stabilize the plasma membrane and control its permeability They are involved in response to acid and oxidative stress They are involved in several processes due to their ability to bind nucleic acids. A major role is played also in the biosynthesis of proteins: Polyamines bind to RNA favouring the assembly of the 30S subunit and increasing the fidelity of the translation process Polyamines exert also a more target-specific action: they affect the translation of several genes, including a number of global regulators, by facilitating the formation of the translation initiation complex

29 EXPRESSION OF VIRULENCEBIOFILM FORMATION Yersina pestis Vibrio cholerae Burkolderia pseudomallei EXPRESSION OF VIRULENCE Streptococcus pneumoniae Shigella/EIEC pathotype Polyamines and bacterial virulence EXPLOITATION OF HOST CELL POLYAMINES Helicobacter pylori macrophage apoptosis, DNA damages Legionella pneumophila bacterial intracellular growth Francisella tularensis disruption of the innate immunity response EXPRESSION of T3SS Salmonella Typhimurium (SP1SP2) Pseudomonas aeruginosa (exsCEBA) Di Martino et al., 2013

30 Comparison of the polyamine biosynthesis pathways in E. coli and Shigella reveals strong differences Cadaverine and acetylspermidine are lost while spermidine accumulates How do the changes in the polyamine pattern influence the Shigella invasive process?

31 Through lysine decarboxylation at low pH cadaverine Through lysine decarboxylation at low pH CadA synthesizes cadaverine, a small polyamine At low pH the release of cadaverine protects the cell from acidification

32 In Shigella /EIEC the lack of cadaverine synthesis is obtained through a convergent evolution Convergent evolution : different strategies , one goal but….the cadC regulatory gene is the preferential target of convergent evolution toward the LCD- phenotype

33 Shigella sonnei is a new emergent pathogen, often associated with shigellosis in industrial countries IS sequences have inactivated the cadBA genes without inducing deletions. Colinearity with the E.coli K12 chromosome is maintained.

34

35

36 Lack of cadaverine activity in ELack of cadaverine activity in E.coli EIEC is induced by IS sequence insertions into the regulatory gene cadC

37 abolishes cadC expressionSilencing of the cadC gene is obtained by different strategies: in one strain a single point mutation in the promoter region abolishes cadC expression ACCAATAATATGTAAATAAACCCATCTATAGATGGT TGGTTATTATACATTTATTTGGGTAGATATCTACCA AAAAATAGGTGGTGGCAATTCTCATTGCATCATTCC TTTTTATCCACCACCGTTAAGAGTAACGTAGTAAGG CTTTTCGAATGAGTTTCTATTATGCAACAA GAAAAGCTTACTCAAAGATAATACGTTGTT +1 -10 -35 AATTCT AATTAT mutant wt

38 Why is the loss of cadaverine a pathoadaptative mutation?The Shigella invasive process is attenuated by cadaverine through: Bacteria M cells Enterocytes Polymorphonuclear Leucocytes (PMNL) Inflammatory cytokines cascade Cadaverine retarding the lysis of Shigella-containing vacuoles decreasing the ability of PMNL to transmigrate Why is the loss of cadaverine a pathoadaptative mutation? DLP12 HolinEndo genes inhibiting ShEt1 and ShEt2 enterotoxin activity

39 Sperimdine accumulation in Shigella: VirF ... … is a 30 kD protein … is an AraC like protein … it acts as H-NS antisilencing factor on the plamid PvirB and PicsA promoter …..it repress the promoter of a sRNA molecule RnaG Giangrossi et al. Nucleic Acid Res. 2010 Tran et al., Nucleic Acid Res. 2011, Sperimdine accumulation in Shigella: a consequence of the acquisition of a VirF regulator?

40 What changes in the transcription profile pINV Vir genes What changes in the transcription profile have been induced by the acquisiton of the plasmid-encoded regulatory factor VirF? virF virF

41 E. coli K12 transcriptome analysis in the presence/absence of VirF shows that VirF-regulated genes can be grouped into… … genes up-regulated by VirF and conserved in Shigella … Gene Expr. Description htpG 10,91 Heat shock chaperone, HSP90 family; has ATPase activity; binds RpoH; rpoH regulon; dimeric trpA 7,14 Tryptophan synthase, subunit A groS/mopA 6,25 Chaperonin Cpn10; GroESL small subunit; phage morphogenesis groL/mopB 6,19 Chaperonin Cpn60; phage morphogenesis; GroESL large subunit, weak ATPase bfr 5,8 Bacterioferritin; negatively regulated by ryhB RNA as part of indirect positive regulation by Fur; 24-mer prmB 4,89 50S subunit L3 protein glutamine methyltransferase sucA 4,47 2-oxoglutarate dehydrogenase, E1 component trpS 3,5 Tryptophan-tRNA ligase Ung 3,26 Uracil-DNA glycosylase carA 3,12 Carbamoylphosphate synthase (glutamine-hydrolysing) light subunit Agp 3,08 Periplasmic glucose-1-phosphatase, acidic; has inositol phosphatase activity

42 … and genes up-regulated by VirF and silenced in Shigella …S.flexneri S.boydii S.dysenteriae S.sonnei B1172 DELETED paaI sgcX speG PSEUDO yaaX yahH yaiX ybhT ycgM yfeY yghD yniB speG is up-regulated more than 5-fold in the presence of VirF codes for spermidine acetyltransferase

43 Molecular rearrangements of the speG locusConvergent Evolution Molecular rearrangements of the speG locus Is speG inactivation conserved in all Shigella species? S. boydii SB227 1609 bp IS600’ hipA’ ‘speG ‘IS911 IS911’ E. coli K12 MG1655 1210bp speG ynfB S. flexneri SF301, 803, 8401, 2457T 1210 bp S. dysenteriae SD197 1984 bp ISO-IS1 speG’ S. sonnei SS046 locus speG deleted 2 bases deletion

44 Spermidine MetabolismARGININE SpeA AdiA METHIONINE MetK AGMANTINE SpeB S-ADENOSYL METHIONINE SpeC SpeF PUTRESCINE ORNITHINE SpeD S-ADENOSYL METHIONINAMINE SpeE SPERMIDINE Intracellular higher levels of spermidine in Shigella cytoplasm SpeG N-ACETYL- SPERMIDINE

45 What is the effect of speG inactivation on Shigella fitness?To answer this question we performed in vivo assays using derivatives of S. flexneri strain M90T: M90T pGPspeG with functional speG gene under control of inducible promoter Ptac SPERMIDINE SpeG N-ACETYL- M90T pACYCspeG with the entire functional ynfB-speG operon with its own promoter complemented strains PUTRESCINE SpeE SPERMIDINE M90T speE defective speE gene which is unable to synthetize spermidine deleted strain

46 Spermidine accumulation increases resistance to oxidative stressA reduced resistance to oxidative stress is paralleled by a decrease of intracellular spermidine Oxidative stress assay with H2O2 (5mM, 30min) on S. flexneri M90T reveals that the presence of speG reduces resistance to oxidative stress Relative survival (%) Minimal medium M90T M90T speE pGPspeG pACYCspeG pAynfBspeG Dosaggio poliammine nmoles/mg protein Polyamine contents

47 speG inactivation improves Shigella fitness against oxidative stressCorrelation between spermidine and oxidative stress Oxidative stress assay with H2O2 on strains unable to synthesize spermidine (speE defective) confirms that survival directly correlates with spermidine (SPD) concentration SPD concentration (mM) Relative survival (%) Minimal medium speE speG inactivation improves Shigella fitness against oxidative stress

48 … so, speG inactivation improves the fitnessofShigella against environmental stresses … … but does speG inactivation improve the fitness of Shigella also inside the host?

49 Intraperitoneal injection in BALB/c miceIntracellular survival of S. flexneri M90T pynfBspeG P ynfB speG Intraperitoneal injection in BALB/c mice M90T pynfB 100 101 102 103 104 105 106 Shigella/105 macrofagi M90T hours post-infection macrophages in collaboration with Prof. Maurizio Sanguinetti The introduction of the speG gene into Shigella reduces bacterial survival within macrophages P< 0,04

50 speG inactivation improves the fitness of Shigella inside the hostCompetitive infection between S. flexneri strains M90TpynfB M90T pynfBspeG J774 M90T pynfB C.I. (Competitive Index) = 0.7 (1 h) 0.4 (2 h)

51 Effect of polyamines to the Shigella invasive processRT-PCR katG speG inactivation induces 8-fold overexpression of katG encoding hydroperoxidase I wt + speG S..flexneri

52 How does Shigella avoid spermidine-mediated toxicity?Accumulation of spermidine is toxic and may inhibit protein synthesis SPERMIDINE SpeG N-ACETYL- In E.coli spermidine is converted into its acetylated form SPD MdtJ MdtI Is spermidine secreted by a specific pump to decrease its intracellular levels ?? MtdJI belongs to the SMR transporter family L-glycerol-3 phosphate, produced by GlpK kinase, complexes spermidine thus reducing its toxic effects P F X K lacZ The level of glpFKX expression in E.coli and Shigella is comparable. glpFKX operon

53 The expression of the “spermidine excretor” operon mdtJI is increased in Shigella and is controlled by VirF and H-NS Northern analysis of the mdtJI transcript mdtI mdtJ H-NS VirF SPD

54

55 Enteroinvasive Escherichia coli (EIEC)toxins LT ST hemolysin-like ST-like SLT ETEC EAggEC EPEC EHEC EIEC Salyers & Whitt, 1994 adapte from They share with Shigella the same pathogenicity process, but exhibit a higher metabolic activity since they retain the ability to catabolize substrates widely used by E.coli

56 The polyamine pattern of enteroivasive E.coli (EIEC), a group of E.coli sharing with Shigella the same invasive process Campilongo et al., PLoS ONE 2014 The analysis of the polyamine pattern indicates that the accumulation of spermidine might be precedeed by cadaverine loss

57 Acquisition of plasmid virF regulatorActivation of the plasmid virulence genes as a function of temperature Up-regulation of several genetic systems, some of which are probably involved in increasing the pathogenicity potential of the ancestral strain Deletion of genes whose up-regulation has a deleterious effect on cell survival or on the establishment of a fruitful host-pathogen interaction Activation of genes involved in the survival of Shigella in the presence of high spermidine level

58 Phages and virulence or ………..antivirulence?Gioacchino Micheli

59 Phages and O-antigen in ShigellaSeveral seroype-converting phages (Sfl) have been isolated in Shigella. They contain genes encoding glucosyltransferase and/or acetyltransferase, responsible for the modification of the O-antigen. Two genes - gtrA and gtrB - are well conserved. They encode proteins involved in the transfer of the glucosyl group, while the third gene (encoding glucosyltransferase) is serotype-specific. SflV phage attP CI cro Gtr 10-150% 90-100% Homology

60 DLP12: an antivirulent prophage?- is a Defective Lambdoid Prophage integrated at 12 min in E. coli chromosome Within its genome DLP12 carries the gene encoding the OmpT protease Loss of OmpT protease All Shigella and EIEC strains have lost the OmpT encoding gene

61 Motility of Shigella is mediated by plasmid-encoded protein IcsApINV Shigella is able to infect epithelial cells, and to move intra- and inter-cellularly, using an actin-mediated motility IcsA induces a rearrangement of the host cytoskeleton by assembling actin tails at one pole of bacterium

62 The loss of the OmpT protease is a pathoadaptive mutation in ShigellaThe absence of OmpT, a surface protease, is an essential requirement for the ability of Shigella to spread intra- and inter-cellularly OmpT degrades the Shigella IcsA protein which is responsible for the formation of the actin tails at one pole of the bacterial cell adler/adlerhp.html The loss of the OmpT protease is a pathoadaptive mutation in Shigella

63 ……not only ompT but also the DLP12 genes encoding the Holin/ Endolysin system are lost in ShigellaessD rrrD rzpD rzoD Holin Endolysin Spanin Lysis operon The Holin / Endolysin system of DLP12 has been “adopted” by E.coli and appears to be involved in remodelling of peptidoglycan during cell division and in the release of not recyclable PNG fragments

64 There is a strong increase of labelled peptidoglycan fragments inDoes the introduction of Holin/Endolysin of DLP12 prophage into S. flexneri increase the release of peptidoglycan components ? There is a strong increase of labelled peptidoglycan fragments in the supernatant of Shigella strains expressing the Holin/Endolysin system DLP12 HolinEndo genes

65 Is the loss of the Holin / Endolysin System of DLP12 prophage a strategy to reduce the inflammatory response of the host? HeLa cells infected with DLP12 HolinEndo genes Within epithelial cells Shigella releases peptidoglycan fragments which activate Nod1/2 proteins and, as a consequence, induce IL-8 expression IL-8 DLP12 HolinEndo genes The introduction of the pLys12 plasmid, carrying the Holin / Endolysin system of DPL12, leads to a strong increase of IL-8 and to the subsequent stimulation of the host immune response.

66 The lack of the “lysis box “of phage DLP12 may be regardedShigella is able to induce an inflammatory response and to exploit it to optimize the invasive process. The lack of the “lysis box “of phage DLP12 may be regarded as a new patho-adaptive mutation, necessary to avoid the massive inflammatory host response which would lead to the elimination of Shigella.

67 The long path of Shigella towards pathogenicity may involve more pathoadaptive mutations…… DLP12 lysis box

68 Mutazioni patoadattative in Shigella

69 Another pathoadaptive mutation: the silencing of nad genes involved in the synthesis of nicotinic acid Quinolic acid (QUIN), the product of the NadA/NadB enzymatic reactions, inhibits both, invasion and intercellular spread ofShigella

70

71

72

73

74 Antivirulence functionsBiochemical activity Antivirulence functions Effects Antivirulence Genes ompT Surface protease Degradation of IcsA outer membrane protein Inhibition of actin-based intracellular motility cadA Lysine decarboxylation Synthesis of cadaverine Attenuation of enterotoxicity; inhibition of PMNs migration; prevention of lysis of Shigella containing phagocitic vacuole nadA, nadB Synthesis of nicotinic Acid Synthesis of QUIN Prevention of intercellular spreading; reduction of PNMs migration; inhibition of T3SS-mediated secretion of IpaB and IpaC speG Spermidine Acetyl Transferase Conversion of spermidine to acetyl‑spermidine Increased sensitivity to oxidative stress; reduction of intracellular survival in macrophages argT Transport of aminoacids Not determined Inhibition of invasion of HeLa cells Potential Antivirulence loci flh Synthesis of flagella Potential activator of host immune system csg Synthesis of curli

75 The expression “cascade” of virulence genesFIS VirF is ... … expressed at 37°C … antagonistically regulated by the nucleoid proteins H-NS and FIS

76 The thermodependent expression of virF is mediated by changes in DNA bending of its promoterProsseda et al, Mol Microbiol. 2004 Prosseda et al., Biochemistry 2010 H-NS and its binding sites FIS and its binding sites RNA polymerase Bending center > 32°C

77 The long path of Shigella towards pathogenicity might involve more pathoadaptive mutations……

78 Acquisition of virF Activation of the plasmid virulence genes as a function of temperature Up-regulation of several genetic systems, some of which are probably involved in increasing the pathogenicity potential of the ancestral strain Deletion of genes whose up-regulation has a deleterious effect on cell survival or on the establishment of a fruitful host-pathogen interaction Activation of genes involved in the survival of Shigella in the presence of high spermidine level

79 Phages and virulence … or antivirulence?

80 Loss of the OmpT proteaseDLP12: an antivirulent prophage? DLP12 is a Defective Lambdoid Prophage integrated at 12 min in theE. coli chromosome Within its genome DLP12 carries the gene encoding the OmpT protease. All Shigella and EIEC strains have lost the OmpT-encoding gene Loss of the OmpT protease

81 The loss of the OmpT protease is a pathoadaptive mutation in ShigellaThe absence of OmpT, a surface protease, is an essential requirement for the ability of Shigella to spread intra- and inter-cellularly OmpT degrades the Shigella IcsA protein which is responsible for the formation of the actin tails at one pole of the bacterial cell adler/adlerhp.html The loss of the OmpT protease is a pathoadaptive mutation in Shigella

82 ……not only ompT but also the DLP12 genes, encoding the Holin / Endolysin system, are lost in Shigella essD rrrD rzpD rzoD Holin Endolysin Spanin Lysis operon The Holin / Endolysin system of DLP12 has been “adopted” by E.coli and appears to be involved in remodelling of peptidoglycan during cell division and in the release of not recyclable PNG fragments

83 There is a strong increase of labelled peptidoglycan fragments inDoes the introduction of Holin / Endolysin of the DLP12 prophage into S. flexneri increase the release of peptidoglycan components? There is a strong increase of labelled peptidoglycan fragments in the supernatant of Shigella strains expressing the Holin/Endolysin system DLP12 HolinEndo genes

84 HeLa cells infected withpLys12 Loss of the Holin /Endolysin System of DLP12 prophage is a strategy to a reduce the inflammatory response of the host? Whin the epithelial cells Shigella releases peptidoglycan fragments which activates Nod2 and as consequence induces IL-8 expression HeLa cells infected with Introductiono the pLys12 plasmid carrying the Holin/Endolysin system of DPL12 leads to a strong increase of IL-8 and the subsequent stimulation of the host immune response. DLP12 HolinEndo genes