1 Fall 2016 - HORT6033 Molecular Plant BreedingInstructor: Ainong Shi

2 Fall 2016 - HORT6033 Molecular Plant BreedingLecture Week 8 (10/10/2016) QTL Mapping Examples

3 QTL Mapping Talk from PublicGenetic Mapping and QTL Analysis at Module 9: Mapping Quantitative Trait Loci (QTL) – CTGN at Youtube: https://www.youtube.com/watch?v=pxQCDODw-CU Quantitative Trait Locus (QTL) Mapping by Eric Xing https://www.cs.cmu.edu/~epxing/Class/ /Lecture9.pdf

4 Linkage Group, Linkage Map, Linkage Mapping, and QTL MappingA linkage map describes the linear order of markers (such as SSRs and SNPs) within a linkage group. A linkage map = a genetic map. Genetic mapping (linkage mapping) means to build genetic map(s) with a set of markers (such as SSRs and/or SNPs). It can map only one genetic map or whole genome maps of a species. Usually, what we say ‘conduct linkage mapping’ means we map a major gene of a trait to a genetic map (linkage group (LG) or chromosome). What we say ‘conduct QTL mapping’ means we map a QTL (quantitative loci trait) to one LG (chromosome) or several LGs (chromosomes) M1 M1 M1 0.1cM 0.1cM 0.1cM M2 M2 M2 0.2cM 0.2cM 0.2cM M3 M3 M3 0.1cM 0.25cM T1 (flower color) 0.25cM 0.15cM M4 M4 M4 0.1cM 0.1cM 0.1cM M6 M5 M6 LG Linkage map QTL mapping

5 Population Development Marker ImplementationQTL Mapping Procedure White rust resistant White rust susceptible X Population Development Phenotypic Data Marker Implementation Donor Screening Data Analysis QTL Mapping Genotypic Data QTL analysis: Single marker test, interval mapping (IM), composite interval mapping (CIM), and multiple-interval mapping (MIM) analysis are performed using Windows QTL Cart V2.5 and QGene and QTLNetworkv2.1. SNP LOD R^2 R298331 8.753 0.378 R347577 6.972 0.315 R296495 6.766 0.307 Marker Identification SNP markers Molecular Breeding

6 QTL Mapping Procedure Population Development P1 x P2 F1 F2 … P1 x P2…… …… …… …… …… …… F2:n n >5 … X x X x X x X x X x X x X x X x X x X x X x X x RILs >=250 F2 individuals >=250 F2:3 Families Recombinant inbred lines

7 Some Points for Mapping PopulationF2 is mainly used for mapping (1) major genes and (2) major QTLs. The phenotypic data are based on single plant in F2. If a trait such as yield can’t be used F2 for QTL mapping because its phenotyping is not reliable based on single plant. F2:3 can be used for any trait, but it can be kept for re-use and also has the dominant effect. RILs can be used for any trait and is the best one for re-use, but it takes years to develop.

8 QTL Mapping Procedure 2. Phonetic Traits and PhenotypingField: white rust in spinach Greenhouse: cowpea bacterial blight

9 Traits Interests for Cowpea Breeding and GeneticsAgronomic traits: grain (seed) yield and forage (leave) yield, 100-seed weight and seed size, maturity day, and processing quality such as seed coat and recovery % imbedded Morphologic traits: Plant habit (erect, semiprostrate, prostrate) Dry pod color (straw, green, purple, black, speckled, brown) Pod placement (above foliage, foliage level, below foliage, and mixed) Pod position (erect, pendant, mixed) Seed pattern color (black, brown, blue, green, grey, purple, red, tan, cream, yellow) Abio- and biotic (disease and pest) resistance/tolerance: Cowpea wilt (Fusarium oxysporum f. sp. tracheiphilum) resistance Cowpea Mosaic Virus resistance (CPMV) Cowpea bacterial blight (CBB) resistance Cowpea aphid tolerance Root-knot nematode (RKN, Meloidogyne spp.) tolerance Iron deficiency chlorosis (IDC) and low phosphorus efficiency Salt, drought, and heat tolerance Seed protein and sugar content Images from google search CPMV CBB Cowpea Wilt Aphid RKN

10

11 Example of phenotypic data distributionField Combined Greenhouse Distribution of disease reaction to F2:3 families derived from a cross of MN0095 and M (Field: the data from the field experiment, and Greenhouse: from the greenhouse; and Combined: combined both field and greenhouse experiments.).

12 QTL Mapping Procedure 3. Genotyping - SNPMotella/LA2823 Mi AAGTAGACGAGGTTAGTAAAAT Mogeor/LA3471 Mi AAGTAGACGAGGTTAGTAAAAT NY mi AAGTAGACGACGTTAGTAAAAT LA3130 mi AAGTAGACGACGTTAGTAAAAT Motella Mogeor G G NY07-464 LA3130 C C

13 Genome-wide SNP DiscoveryDNA Extraction Genotyping by sequencing (GBS) ddRADseq Whole genome sequencing (WGS) Whole genome resequencing SNP Discovery Spinach Germplasm Data Analysis

14 QTL Mapping Procedure 4. Data AnalysisWe will use the example data to do QTL mapping using five tools: JoinMap, MSTmap, WinQTLCart, QGene, QTLNetwork, and Mapchart. JoinMap is used to create the genetic maps for the population; WinQTLCart, QGene, and QTLNetwork are used to conduct QTL analysis and identify SNP markers associated with the traits; and Mapchart is used to create a nice looking images for the QTL maps. The tools web sites are: JoinMap 4.1: MSTmap: WinQTLCart: Qgene: QTLNetwork 2: Mapchart 2.2: https://www.wageningenur.nl/en/show/Mapchart.htm R/QTL: Please download the software and the user manuals! And then install them to you computers.

15 QTL Mapping Procedure 4. Data Analysis 4-1 Construct of Genetic MapsTools: JoinMap, MASTmap We use WinQTLCart to create the genetic maps (leaf figure)

16 QTL Mapping Procedure 4. Data Analysis 4-2 QTL mapping by WinQTLCartQTLs on LG1, 4, and 20 from WinQTLCart

17 QTL Mapping Procedure 4. Data Analysis 4-3 QTL mapping by QgeneQTLs on LG1, 4, and 20 from QGene

18 QTL Mapping Procedure 4. Data Analysis 4-4 QTL mapping by QTLnetwork

19 QTL Mapping Procedure 4. Data Analysis 4-5 Draw QTL mappingfigures by Mapchart

20 QTL Mapping Procedure 5. SNP Identification SNP marker ExptR-square (%) QTL M M Field 35.44 QTL1 + QTL2 Gh 41.52 combined 38.82 M 28.33 QTL1 35.02 31.38 5.29 QTL2 11.76 7.95